domingo, 18 de setembro de 2016

Ciências Naturais - ADN - Símbolo de Vida

ADN, Ácido DesoxirriboNucleico, é uma molécula biológica universal presente em todas as células vivas. É no ADN que está contida toda a nossa informação genética, sob a forma de genes. O ADN é constituído por quatro tipos de nucleótidos , unidade básica do ADN (que por sua vez é constituído por uma pentose, um grupo fosfato e uma base azotada), que se associam de uma forma específica, formando uma cadeia dupla: adenina (A) com timina (T) e guanina (G) com citosina (C). Os nucleótidos são designados deste modo devido às bases azotadas que entram nas suas constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de letras, como por exemplo, ATGATTCTGTAGCCTGATCCC,  a uma sequência completa de ADN dá-se o  nome de genoma.
O ADN tem a forma de uma escada de corda enrolada helicoidalmente, ou seja, de uma hélice dupla em que os degraus são formados por pares de bases azotadas ligadas entre si, através de ligações de hidrogénio, com fundamento na complementaridade de bases. A estrutura, do ADN, foi proposta há 53 anos por James Watson e Francis Crick. A descoberta da estrutura do ADN abriu o caminho para se compreender como é que a informação genética é transmitida de progenitores para descendentes, ou de uma célula para outra, isto é, como funciona a hereditariedade.
Hoje em dia, esta descoberta tem um impacto em muitas áreas da vida moderna, tais como a medicina, a reprodução, a alimentação, a longevidade e o ambiente. No caso da medicina, e da saúde, há milhares de doenças hereditárias diferentes: cada uma resulta de um defeito num gene, muitos dos quais agora conhecemos. Assim, sabe-se detectar esses defeitos antes da nascença e tem-se esperança de os poder corrigir dentro de algum tempo, utilizando a terapia génica. Os testes genéticos permitem prever as doenças genéticas a que um indivíduo está mais sujeito e preveni-las a tempo. A amniocentese é um exemplo de um teste genético pré-natal que é muito usado para detectar se um bebé irá sofrer o síndroma de Down, mais conhecido como mongolismo, e que resulta da duplicação do cromossoma 21. Outro exemplo de influência genética é na reprodução, são as  técnicas de fertilização in vitro (FIV) que permitem que hoje muitos casais inférteis possam ter filhos. Aliado à FIV está o diagnóstico genético preimplantatório, que permite detectar, nos embriões, erros no ADN que causam doenças, reduzindo-se assim a probabilidade de a criança nascer com uma doença genética. Este diagnóstico não pode, contudo, ser usado para excluir embriões com características estéticas e sociais não desejadas, como por exemplo, cor dos olhos, sexo ou inteligência. Outro assunto em que a genética influencia é na alimentação pois através da engenharia genética é agora possível produzir alimentos mais baratos, mais energéticos e mais res istentes a pragas e à seca, sem poluir o ambiente nem gastar tanta água. Igual interferência genética dá-se na longevidade celular, resta agora continuar estes estudos de forma a descobrir como se impede o envelhecimento das células e como se reparam os estragos naturais das células velhas, estudos elaborados na mosca da fruta e numa espécie de lombrigas já identificaram certos genes responsáveis pelo prolongamento da longevidade. No ambiente o ADN é uma importante ferramenta para se salvarem espécies de animais e de plantas em perigo de extinção e mesmo para se trazerem de volta algumas que tenham desaparecido recentemente. O ADN traz a possibilidade de se criarem novas bactérias geneticamente modificadas que sejam capazes de limpar o ambiente de toxinas nocivas, pois decompõem resíduos orgânicos (nocivos para o ambiente) e transformam-nos em água e dióxido de carbono.
É, também, através do ADN, que se podem criar os «bilhetes de Identidade genéticos» isto é, a partir dos genes de ADN que se encontram no núcleo das nossas células é possível reconhecer a nossa identidade de uma maneira que ninguém o possa negar, pois o nosso ADN é único. Ou então pode-se verificar a vericidade dos progenitores, com o teste de paternidade.
Enviar um comentário
Related Posts Plugin for WordPress, Blogger...

Mensagens populares


Recomendamos ...